PCR:	Mpl-KO mut/wt
Name of Positive CTRL:	Mpl-KO mut/wt
Annealing Temperature:	0.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 65
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Mpl mut rev	929	100 µM	10.0 µl for 1ml	GAGCAAGGTGAGATGACAGG
	Mpl wt fwd	930	100 µM	10.0 µl for 1ml	GGTATGTGTGCCAGTTTCCA
	Mpl wt rev	931	100 µM	10.0 µl for 1ml	AAGTTCCCCTGGTTGGCT
	neo-5	625	100 µM	10.0 µl for 1ml	GGAGAGGCTATTCGGCTATG
Expected Bands:	Band Size: 280.0	Description: 280 mut	(text displayed in the image)
	Band Size: 914.0	Description: 914 wt	(text displayed in the image)
More Information in PDF:		view PDF