PCR:	Mpl-KO wt
Name of Positive CTRL:	Mpl-KO wt
Annealing Temperature:	0.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 65
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Mpl wt fwd	930	100 µM	10.0 µl for 1ml	GGTATGTGTGCCAGTTTCCA
	Mpl wt rev	931	100 µM	10.0 µl for 1ml	AAGTTCCCCTGGTTGGCT
Expected Bands:	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
	Band Size: 914.0	Description: 914 wt	(text displayed in the image)
More Information in PDF:		view PDF