PCR:	Psen1
Name of Positive CTRL:	Psen1 - mutant
Annealing Temperature:	69.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 70
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Psen1 fwd	925	100 µM	10.0 µl for 1ml	AGGCAGGAAGATCACGTGTTCAAGTAC
	Psen1 rev	926	100 µM	10.0 µl for 1ml	CACACGCACACTCTGACATGCACAGGC
Expected Bands:	no expected bands in db
More Information in PDF:		view PDF