PCR:	vgat-cre
Name of Positive CTRL:	vgat-cre
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 62
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	12785	920	100 µM	20.0 µl for 1ml	CTTCGTCATCGGCGGCATCTG
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	oIMR8292	922	100 µM	20.0 µl for 1ml	CCAAAAGACGGCAATATGGT
Expected Bands:	Band Size: 200.0	Description: 200 mut	(text displayed in the image)
	Band Size: 510.0	Description: 510 actin	(text displayed in the image)
More Information in PDF:		view PDF