PCR:	D1-cre
Name of Positive CTRL:	D1-cre
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	D1-cre F	918	100 µM	10.0 µl for 1ml	GCTATGGAGATGCTCCTGATGGAA
	D1-cre R	919	100 µM	10.0 µl for 1ml	CGGCAAACGGACAGAAGCATT
Expected Bands:	Band Size: 340.0	Description: 340 tg	(text displayed in the image)
More Information in PDF:		view PDF