| PCR: | A2A-cre | ||||
| Name of Positive CTRL: | A2A-cre | Annealing Temperature: | 0.0 °C | ||
| Number of cycles: | 0.0 | Extension Time: | 0 s | ||
| Hot Start: | HS 57 | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| A2A-cre F | 916 | 100 µM | 10.0 µl for 1ml | GGGCAAGATGGGAGTCATT | |
| A2A-cre R | 917 | 100 µM | 10.0 µl for 1ml | ATTCTGCATCTCCCGAAACC | |
| Expected Bands: | Band Size: 182.0 | Description: 182 wt | (text displayed in the image) | ||
| Band Size: 220.0 | Description: 220 mut | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||