PCR: | tetO-TARDBP |
Name of Positive CTRL: | tetO-TARDBP |
Annealing Temperature: | 0.0 °C | Number of cycles: | 0.0 |
Extension Time: | 0 s | Hot Start: | HS 57 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| oIMR8745 | 890 | 100 µM | 10.0 µl for 1ml | GTCAGTCGAGTGCACAGTTT |
| Terd fw | 555 | 100 µM | 10.0 µl for 1ml | CAA ATG TTG CTT GTC TGG TG |
| tetO-TARDBP_for | 914 | 100 µM | 10.0 µl for 1ml | TTGCGTGACTCTTTAGTATTGGTTTGATGA |
| tetO-TARDBP_rev | 915 | 100 µM | 10.0 µl for 1ml | CTCATCCATTGCTGCTGCG |
|
Expected Bands: | Band Size: 200.0 | Description: 200 ctrl | (text displayed in the image) |
| Band Size: 480.0 | Description: 480 tg | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|