PCR:	NEFH-tTA
Name of Positive CTRL:	NEFH-tTA
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	NEFH-tTA8_for	912	100 µM	10.0 µl for 1ml	CTCGCGCACCTGCTGAAT
	NEFH-tTA8_rev	913	100 µM	10.0 µl for 1ml	CAGTACAGGGTAGGCTGCTC
	oIMR7338	487	100 µM	10.0 µl for 1ml	CTA GGC CAC AGA ATT GAA AGA TCT
	oIMR7339	488	100 µM	10.0 µl for 1ml	GTA GGT GGA AAT TCT AGC ATC ATC C
Expected Bands:	Band Size: 151.0	Description: 151 tg	(text displayed in the image)
	Band Size: 324.0	Description: 324 ctrl	(text displayed in the image)
More Information in PDF:		view PDF