PCR: 1Khakh
Name of Positive CTRL:1Khakh
Annealing Temperature:0.0 °C
Number of cycles:0.0
Extension Time:0 s
Hot Start:Not yet
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
21238906100 µM10.0 µl for 1mlCTGTCCCTGTATGCCTCTGG
21239907100 µM10.0 µl for 1mlAGATGGAGAAAGGACTAGGCTACA
30308 R908100 µM10.0 µl for 1mlGGCAAACGGACAGAAGCA
31091 F909100 µM10.0 µl for 1mlCTTCAACAGGTGCCTTCCA
Expected Bands:Band Size: 198.0Description: tg(text displayed in the image)
Band Size: 415.0Description: ctrl(text displayed in the image)
 
More Information in PDF: view PDF