PCR: | 1Khakh |
Name of Positive CTRL: | 1Khakh |
Annealing Temperature: | 0.0 °C | Number of cycles: | 0.0 |
Extension Time: | 0 s | Hot Start: | Not yet |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 21238 | 906 | 100 µM | 10.0 µl for 1ml | CTGTCCCTGTATGCCTCTGG |
| 21239 | 907 | 100 µM | 10.0 µl for 1ml | AGATGGAGAAAGGACTAGGCTACA |
| 30308 R | 908 | 100 µM | 10.0 µl for 1ml | GGCAAACGGACAGAAGCA |
| 31091 F | 909 | 100 µM | 10.0 µl for 1ml | CTTCAACAGGTGCCTTCCA |
|
Expected Bands: | Band Size: 198.0 | Description: tg | (text displayed in the image) |
| Band Size: 415.0 | Description: ctrl | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|