| PCR: | Tgfbr1 | ||||
| Name of Positive CTRL: | Tgfbr1 | Annealing Temperature: | 0.0 °C | ||
| Number of cycles: | 0.0 | Extension Time: | 0 s | ||
| Hot Start: | HS 57 | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 28297 F | 904 | 100 µM | 10.0 µl for 1ml | CCTGCAGTAAACTTGGAATAAGAAG | |
| 28298 R | 905 | 100 µM | 10.0 µl for 1ml | GACCATCAGCTGTCAGTACCC | |
| Expected Bands: | Band Size: 219.0 | Description: 219 wt | (text displayed in the image) | ||
| Band Size: 320.0 | Description: 320 Mut | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||