| PCR: | Adgrd1 | ||||
| Name of Positive CTRL: | Adgrd1 | Annealing Temperature: | 0.0 °C | ||
| Number of cycles: | 0.0 | Extension Time: | 0 s | ||
| Hot Start: | HS 60 | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Gpr133_222_Fw | 897 | 100 µM | 10.0 µl for 1ml | CTGGGGTGAGAGATGTGCTG | |
| Gpr1333_222_Rv | 898 | 100 µM | 10.0 µl for 1ml | CTACCCACTCCTCTACCAGCC | |
| Expected Bands: | Band Size: 170.0 | Description: 170 tg | (text displayed in the image) | ||
| Band Size: 295.0 | Description: 295 wt | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||