PCR:	tm1Knt
Name of Positive CTRL:	tm1Knt
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	13785	896	100 µM	10.0 µl for 1ml	CCTCTGCTTCATCCCTTGTG
	13787	899	100 µM	10.0 µl for 1ml	TGAAAGCATGGTCATTCCTG
	IMR6916	491	100 µM	10.0 µl for 1ml	CTT GGG TGG AGA GGC TAT TC
	IMR6917	492	100 µM	10.0 µl for 1ml	AGG TGA GAT GAC AGG AGA TC
Expected Bands:	Band Size: 280.0	Description: 280 Mut	(text displayed in the image)
	Band Size: 559.0	Description: 559 wt	(text displayed in the image)
More Information in PDF:		view PDF