PCR:	1Bhk
Name of Positive CTRL:	1Bhk
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	9155	900	100 µM	10.0 µl for 1ml	GCTCCAGATGGCGTGTTAGC
	9156	901	100 µM	10.0 µl for 1ml	TCCAGAAAGTAGTGAGAGGC
	oIMR7338	487	100 µM	10.0 µl for 1ml	CTA GGC CAC AGA ATT GAA AGA TCT
	oIMR7339	488	100 µM	10.0 µl for 1ml	GTA GGT GGA AAT TCT AGC ATC ATC C
Expected Bands:	Band Size: 324.0	Description: 324 cntr	(text displayed in the image)
	Band Size: 561.0	Description: 561 tg	(text displayed in the image)
More Information in PDF:		view PDF