| PCR: | dCas9-SPH |
| Name of Positive CTRL: | dCas9-SPH |
Annealing Temperature: | 0.0 °C | | Number of cycles: | 0.0 |
Extension Time: | 0 s | | Hot Start: | HS 50 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 15020 | 893 | 100 µM | 10.0 µl for 1ml | CTGAACTTGTGGCCGTTTAC |
| 31704 | 881 | 100 µM | 10.0 µl for 1ml | AGTGGCCTCTTCCAGAAATG |
| 31705 | 880 | 100 µM | 10.0 µl for 1ml | TGCGACTGTGTCTGATTTCC |
| 40967 | 895 | 100 µM | 10.0 µl for 1ml | CACCATCTCCCTGCTGACA |
|
| Expected Bands: | Band Size: 264.0 | Description: 264 tg | (text displayed in the image) |
| Band Size: 521.0 | Description: 521 ctrl | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |