| PCR: | Thy1-APP |
| Name of Positive CTRL: | Thy1-APP |
Annealing Temperature: | 0.0 °C | | Number of cycles: | 0.0 |
Extension Time: | 0 s | | Hot Start: | HS 53 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 31704 | 881 | 100 µM | 10.0 µl for 1ml | AGTGGCCTCTTCCAGAAATG |
| 31705 | 880 | 100 µM | 10.0 µl for 1ml | TGCGACTGTGTCTGATTTCC |
| 34686 | 879 | 100 µM | 10.0 µl for 1ml | CAGGAGCAGTGCCAAACC |
| YFP primer 1 | 553 | 100 µM | 10.0 µl for 1ml | TCT GAG TGG CAA AGG ACC TTA GG |
|
| Expected Bands: | Band Size: 250.0 | Description: 250 tg | (text displayed in the image) |
| Band Size: 521.0 | Description: 521 ctrl | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |