PCR:	PD-1
Name of Positive CTRL:	PD-1
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mPD-1F850	865	100 µM	10.0 µl for 1ml	CTCGGCCATGGGACGTAGGG
	mPD-1KO31	867	100 µM	10.0 µl for 1ml	TTGTGTAGCGCCAAGTGCCCAGCG
	mPD-1R950	866	100 µM	10.0 µl for 1ml	GGGTCTGCAGCATGCTAATGGCTG
Expected Bands:	Band Size: 125.0	Description: 125 wt	(text displayed in the image)
	Band Size: 207.0	Description: 207 mut	(text displayed in the image)
More Information in PDF:		view PDF