PCR:	Otub1c
Name of Positive CTRL:	Otub1c
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Ef_1_5272	877	100 µM	20.0 µl for 1ml	TCCACCCCTTCATCCTGCTTTCT
	Er_5277	878	100 µM	20.0 µl for 1ml	CAGACCAGAGCAGGATTAAGAAGCCTA
Expected Bands:	Band Size: 329.0	Description: 329 wt	(text displayed in the image)
	Band Size: 459.0	Description: 459 mut	(text displayed in the image)
More Information in PDF:		view PDF