PCR:	HaPrP
Name of Positive CTRL:	HaPrP
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 50
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Ha1	875	100 µM	10.0 µl for 1ml	CTCCTTCTGATACTGGGTGGTA
	Ha2	876	100 µM	10.0 µl for 1ml	AACCGTTTACCCACCTCAGGT
Expected Bands:	Band Size: 247.0	Description: 247 mTUBB	(text displayed in the image)
	Band Size: 530.0	Description: 530 HaPrP	(text displayed in the image)
More Information in PDF:		view PDF