PCR:	FLP recombinase wt
Name of Positive CTRL:	FLP recombinase wt
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	oIMR1427	873	100 µM	20.0 µl for 1ml	TGTTTTGGAGGCAGGAAGCACTTG
	oIMR1428	874	100 µM	20.0 µl for 1ml	AAATACTCCGAGGCGGATCACAAG
Expected Bands:	Band Size: 247.0	Description: 247 mTUBB	(text displayed in the image)
	Band Size: 500.0	Description: 500 wt	(text displayed in the image)
More Information in PDF:		view PDF