PCR:	FLP recombinase mut
Name of Positive CTRL:	FLP recombinase mut
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 50
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	oIMR1348	871	100 µM	20.0 µl for 1ml	CACTGATATTGTAAGTAGTTTGC
	oIMR1349	872	100 µM	20.0 µl for 1ml	CTAGTGCGAAGTAGTGATCAGG
Expected Bands:	Band Size: 247.0	Description: 247 mTUBB	(text displayed in the image)
	Band Size: 725.0	Description: 725 mut	(text displayed in the image)
More Information in PDF:		view PDF