PCR: | FLP recombinase mut |
Name of Positive CTRL: | FLP recombinase mut |
Annealing Temperature: | 0.0 °C | Number of cycles: | 0.0 |
Extension Time: | 0 s | Hot Start: | HS 50 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| mTUBB5-247 F | 277 | 100 µM | 10.0 µl for 1ml | CGG CCA CCA TGA GCG GCG TC |
| mTUBB5-247 R | 392 | 100 µM | 10.0 µl for 1ml | GTG AGG TAC CGG CCG TGG CG |
| oIMR1348 | 871 | 100 µM | 20.0 µl for 1ml | CACTGATATTGTAAGTAGTTTGC |
| oIMR1349 | 872 | 100 µM | 20.0 µl for 1ml | CTAGTGCGAAGTAGTGATCAGG |
|
Expected Bands: | Band Size: 247.0 | Description: 247 mTUBB | (text displayed in the image) |
| Band Size: 725.0 | Description: 725 mut | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|