PCR:	Ptgs2 wt
Name of Positive CTRL:	Ptgs2 wt
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 53
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	36746	869	100 µM	20.0 µl for 1ml	CCATTAGCAGCCAGTTGTCA
	36747	870	100 µM	20.0 µl for 1ml	TGCTAGAAAGGGGGTCTGAG
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
Expected Bands:	Band Size: 245.0	Description: 245 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF