PCR: | PDGFR-CreERT2 |
Name of Positive CTRL: | PDGFR-CreERT2 |
Annealing Temperature: | 50.0 °C | Number of cycles: | 0.0 |
Extension Time: | 0 s | Hot Start: | HS 50 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Actin fwd | 114 | 100 µM | 10.0 µl for 1ml | TGT TAC CAA CTG GGA CGA CA |
| Actin rev | 115 | 100 µM | 10.0 µl for 1ml | GAC ATG CAA GGA GTG CAA GA |
| CRE1 | 716 | 100 µM | 20.0 µl for 1ml | GCCTGCATTACCGGTCGATGCAACGA |
| CRE2 | 717 | 100 µM | 20.0 µl for 1ml | GTGGCAGATGGCGCGGCAACACCATT |
|
Expected Bands: | Band Size: 500.0 | Description: actin 500 | (text displayed in the image) |
| Band Size: 720.0 | Description: 720 Cre | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|