PCR:	ASC_1
Name of Positive CTRL:	ASC_1
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m_ASC fwd	861	100 µM	10.0 µl for 1ml	GAAGCTGCTGACAGTGCAAC
	m_ASC rev	862	100 µM	10.0 µl for 1ml	CTCCAGGTCCATCACCAAGT
	Neo fwd	863	100 µM	10.0 µl for 1ml	TGGGACCAACAGACAATCGG
	Neo rev	864	100 µM	10.0 µl for 1ml	TGGATACTTTCTCGGCAGGAGC
Expected Bands:	Band Size: 275.0	Description: 275 NEO	(text displayed in the image)
	Band Size: 859.0	Description: 859 ASC	(text displayed in the image)
More Information in PDF:		view PDF