PCR:	townes_C
Name of Positive CTRL:	townes_C
Annealing Temperature:	57.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	11127	858	100 µM	10.0 µl for 1ml	TTGAGCAATGTGGACAGAGAAGG
	11129	857	100 µM	10.0 µl for 1ml	AATTCTGGCTTATCGGAGGCAAG
	Actin fwd	114	100 µM	5.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	5.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
Expected Bands:	Band Size: 250.0	Description: 250 HbSS	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
More Information in PDF:		view PDF