PCR:	H2R mut
Name of Positive CTRL:	H2R mut
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	30875	851	100 µM	20.0 µl for 1ml	CAGCACTTCCAACCCACAC
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	oIMR7415	852	100 µM	20.0 µl for 1ml	GCCAGAGGCCACTTGTGTAG
Expected Bands:	Band Size: 210.0	Description: 210 mut	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF