PCR:	H2R wt
Name of Positive CTRL:	H2R wt
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	30874	850	100 µM	20.0 µl for 1ml	TGGTTGGGTTATGCCAATTC
	30875	851	100 µM	20.0 µl for 1ml	CAGCACTTCCAACCCACAC
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
Expected Bands:	Band Size: 280.0	Description: 280 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF