| PCR: | CD48 |
| Name of Positive CTRL: | CD48 |
Annealing Temperature: | 0.0 °C | | Number of cycles: | 0.0 |
Extension Time: | 0 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| CD48 common | 834 | 100 µM | 5.0 µl for 1ml | TAGGTTGCCTACAGGGTGGA |
| CD48 mut rev | 833 | 100 µM | 2.5 µl for 1ml | CTTCCTGACTAGGGGAGGAG |
| CD48 wt fwd | 832 | 100 µM | 7.5 µl for 1ml | CATTTCCCAATAGCCCATTC |
|
| Expected Bands: | Band Size: 226.0 | Description: 226 wt | (text displayed in the image) |
| Band Size: 400.0 | Description: 400 mut | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |