| PCR: | TRAP-CreERT2 |
| Name of Positive CTRL: | TRAP-CreERT2 |
Annealing Temperature: | 57.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| TRAP common | 848 | 100 µM | 10.0 µl for 1ml | GAACCTTCGAGGGAAGACG |
| TRAP mut fw | 849 | 100 µM | 10.0 µl for 1ml | CCTTGCAAAAGTATTACATCACG |
| TRAP wt fw | 847 | 100 µM | 10.0 µl for 1ml | GTCCGGTTCCTTCTATGCAG |
|
| Expected Bands: | Band Size: 232.0 | Description: 232 mut | (text displayed in the image) |
| Band Size: 357.0 | Description: 357 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |