| PCR: | Csf1r flox | ||||
| Name of Positive CTRL: | Csf1r flox | Annealing Temperature: | 0.0 °C | ||
| Number of cycles: | 0.0 | Extension Time: | 0 s | ||
| Hot Start: | HS 60 | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 16422 | 845 | 100 µM | 10.0 µl for 1ml | GGACTAGCCACCATGTCTCC | |
| 26825 | 846 | 100 µM | 20.0 µl for 1ml | CATGGCTGTGGCCTAGAGA | |
| Expected Bands: | Band Size: 193.0 | Description: 193 wt | (text displayed in the image) | ||
| Band Size: 273.0 | Description: 273 mut | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||