PCR: Oxtr-Cre mut
Name of Positive CTRL:Oxtr-Cre mut
Annealing Temperature:0.0 °C
Number of cycles:0.0
Extension Time:0 s
Hot Start:HS 60
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
13007842100 µM20.0 µl for 1mlACACCGGCCTTATTCCAAG
36561841100 µM20.0 µl for 1mlTGACACCTGTTCTCTTTTCCTC
Actin fwd114100 µM10.0 µl for 1mlTGT TAC CAA CTG GGA CGA CA
Actin rev115100 µM10.0 µl for 1mlGAC ATG CAA GGA GTG CAA GA
Expected Bands:Band Size: 350.0Description: 350 mut(text displayed in the image)
Band Size: 500.0Description: 500 Actin(text displayed in the image)
 
More Information in PDF: view PDF