PCR:	IRlox
Name of Positive CTRL:	IRlox
Annealing Temperature:	58.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	IRlox fwd	835	100 µM	10.0 µl for 1ml	GATGTGCACCCCATGTCTG
	Irlox rev	836	100 µM	10.0 µl for 1ml	CTGAATAGCTGAGACCACAG
Expected Bands:	Band Size: 279.0	Description: 279 wt	(text displayed in the image)
	Band Size: 313.0	Description: 313 IRlox	(text displayed in the image)
More Information in PDF:		view PDF