PCR:	DAT-cre_slc
Name of Positive CTRL:	DAT-cre_slc
Annealing Temperature:	57.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	DATcre_scl common	837	100 µM	10.0 µl for 1ml	TGGCTGTTGGTGTAAAGTGG
	DATcre_slc mut rev	839	100 µM	10.0 µl for 1ml	CCAAAAGACGGCAATATGGT
	DATcre_slc wt rev	838	100 µM	10.0 µl for 1ml	GGACAGGGACATGGTTGACT
Expected Bands:	Band Size: 152.0	Description: 152 mut	(text displayed in the image)
	Band Size: 264.0	Description: 264 wt	(text displayed in the image)
More Information in PDF:		view PDF