PCR:	Ai162
Name of Positive CTRL:	Ai162
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 65
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	TITL2 _MG-2683-R	830	100 µM	10.0 µl for 1ml	ATTGGCCGGCCGAAAGAAGTT
	TITL2_MG-2007_F	829	100 µM	10.0 µl for 1ml	TAGGGAAGCACTGGCCAAAGGAA
	TITL2_MG-2616_N	831	100 µM	10.0 µl for 1ml	CATCCCAAAGTTAGGTGTTATGGCAGT
Expected Bands:	Band Size: 440.0	Description: 440 wt	(text displayed in the image)
	Band Size: 505.0	Description: 505 mut	(text displayed in the image)
More Information in PDF:		view PDF