PCR:	SF1 cre
Name of Positive CTRL:	SF1 cre
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	SF1 cre fwd	825	100 µM	20.0 µl for 1ml	CTGAGCTGCAGCGCAGGGACAT
	SF1 cre rev	826	100 µM	20.0 µl for 1ml	TGCGAACCTCATCACTCGTTGCAT
Expected Bands:	Band Size: 250.0	Description: 250 tg	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF