| PCR: | XAF1del4 |
| Name of Positive CTRL: | XAF1del4 |
Annealing Temperature: | 62.0 °C | | Number of cycles: | 0.0 |
Extension Time: | 0 s | | Hot Start: | HS 62 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| m28s rDNA 225 F | 390 | 10 µM | 10.0 µl for 1ml | CAG ACG TGG CGA CCC GCT GA |
| m28s rDNA-225 R | 276 | 10 µM | 10.0 µl for 1ml | GCC TCA CAC CGT CCA CGG GC |
| XAF1 del6 fwd | 811 | 100 µM | 20.0 µl for 1ml | TGCCAACAGCCCTAGCTAAC |
| XAF1del4 rev | 823 | 100 µM | 20.0 µl for 1ml | GGCAAAGGACTATGACAGGCA |
|
| Expected Bands: | Band Size: 225.0 | Description: 225 m28s | (text displayed in the image) |
| Band Size: 430.0 | Description: 430 del | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |