PCR:	Ai148mut
Name of Positive CTRL:	Ai148mut
Annealing Temperature:	60.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	Ai148mut fw	818	10 µM	10.0 µl for 1ml	AAGTTATCACGCGCCATTTG
	Ai148mut rev	819	10 µM	10.0 µl for 1ml	GGGGTGTTCTGCTGGTAGTG
Expected Bands:	Band Size: 334.0	Description: 334 mut	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
More Information in PDF:		view PDF