PCR:	S1P1 mut
Name of Positive CTRL:	S1P1 mut
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 62
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	ML127 Wt+Ki	820	100 µM	20.0 µl for 1ml	AGATGGCGGTAACTCTGAGG
	ML170	821	100 µM	20.0 µl for 1ml	GGTTAGTGGTTGGCGATTAAATGCTGA
Expected Bands:	Band Size: 228.0	Description: 228 m28s	(text displayed in the image)
	Band Size: 612.0	Description: 612 mut	(text displayed in the image)
More Information in PDF:		view PDF