PCR: AgRP mut
Name of Positive CTRL:AgRP mut
Annealing Temperature:60.0 °C
Number of cycles:0.0
Extension Time:0 s
Hot Start:HS 60
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
m28s rDNA 225 F39010 µM10.0 µl for 1mlCAG ACG TGG CGA CCC GCT GA
m28s rDNA-225 R27610 µM10.0 µl for 1mlGCC TCA CAC CGT CCA CGG GC
PR 311813100 µM20.0 µl for 1mlGCTTCTTCAATGCCTTTTGC
PR 313815100 µM20.0 µl for 1mlAGGAACTGCTTCCTTCACGA
Expected Bands:Band Size: 225.0Description: 225 m28s(text displayed in the image)
Band Size: 280.0Description: 280 mut(text displayed in the image)
 
More Information in PDF: view PDF