PCR:	AgRP mut
Name of Positive CTRL:	AgRP mut
Annealing Temperature:	60.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	PR 311	813	100 µM	20.0 µl for 1ml	GCTTCTTCAATGCCTTTTGC
	PR 313	815	100 µM	20.0 µl for 1ml	AGGAACTGCTTCCTTCACGA
Expected Bands:	Band Size: 225.0	Description: 225 m28s	(text displayed in the image)
	Band Size: 280.0	Description: 280 mut	(text displayed in the image)
More Information in PDF:		view PDF