PCR:	F35
Name of Positive CTRL:	F35
Annealing Temperature:	0.0 °C
Number of cycles:	0.0
Extension Time:	0 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	Mut217	88	100 µM	20.0 µl for 1ml	cctgggactccttctggtaccgggtgacgc
	pE2	2	100 µM	20.0 µl for 1ml	caaccgagctgaagcattctgcct
Expected Bands:	Band Size: 242.0	Description: 242 m28sr	(text displayed in the image)
	Band Size: 415.0	Description: 415 tg	(text displayed in the image)
More Information in PDF:		view PDF