PCR:	XAF1 del6
Name of Positive CTRL:	XAF1 del6
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	72 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	XAF1 del6 fwd	811	100 µM	20.0 µl for 1ml	TGCCAACAGCCCTAGCTAAC
	XAF1 del6 rev	812	100 µM	20.0 µl for 1ml	GGCAAAGGACTATGAAGCAGT
Expected Bands:	Band Size: 247.0	Description: 247 mTUBB	(text displayed in the image)
	Band Size: 430.0	Description: 430 XAF1	(text displayed in the image)
More Information in PDF:		view PDF