PCR:	Sst Cre
Name of Positive CTRL:	Sst Cre
Annealing Temperature:	60.0 °C
Number of cycles:	28.0
Extension Time:	10 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	11224	808	100 µM	20.0 µl for 1ml	GGGCCAGGAGTTAAGGAAGA
	11225	809	100 µM	10.0 µl for 1ml	TCTGAAAGACTTGCGTTTGG
	9989	810	100 µM	10.0 µl for 1ml	TGGTTTGTCCAAACTCATCAA
Expected Bands:	Band Size: 200.0	Description: 200 mut	(text displayed in the image)
	Band Size: 465.0	Description: 465 wt	(text displayed in the image)
More Information in PDF:		view PDF