| PCR: | Vip-cre |
| Name of Positive CTRL: | Vip-cre |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 15 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 9527 | 802 | 100 µM | 10.0 µl for 1ml | CCCCCTGAACCTGAAACATA |
| 9984 | 803 | 100 µM | 20.0 µl for 1ml | GGACACAGTAAGGGCACACA |
| 9985 | 804 | 100 µM | 10.0 µl for 1ml | TCCTTGGAACATTCCTCAGC |
|
| Expected Bands: | Band Size: 175.0 | Description: 175 wt | (text displayed in the image) |
| Band Size: 350.0 | Description: 350 mut | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |