| PCR: | MPAG |
| Name of Positive CTRL: | MPAG |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 30 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Control 1 | 798 | 100 µM | 10.0 µl for 1ml | GAGACTCTGGCTACTCATCC |
| Control 2 | 799 | 100 µM | 10.0 µl for 1ml | CCTTCAGCAAGAGCTGGGGAC |
| Oligo 5 F | 796 | 100 µM | 20.0 µl for 1ml | GAGTGACATTTGTGAGACCAGC |
| Oligo 6 R | 797 | 100 µM | 20.0 µl for 1ml | ACACAGCTAGGTTGTAGCATCC |
|
| Expected Bands: | Band Size: 340.0 | Description: 340 tg | (text displayed in the image) |
| Band Size: 585.0 | Description: 585control | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |