| PCR: | XAF1 KO | ||||
| Name of Positive CTRL: | XAF1 KO | Annealing Temperature: | 60.0 °C | ||
| Number of cycles: | 35.0 | Extension Time: | 30 s | ||
| Hot Start: | HS 60 | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| XAF1 KO fwd | 794 | 100 µM | 20.0 µl for 1ml | GCAGGCCTGGAAAGAGCTTA | |
| XAF1 KO rev | 795 | 100 µM | 20.0 µl for 1ml | GGACAGCCTCAGGGTAACAC | |
| Expected Bands: | Band Size: 366.0 | Description: 366 mut | (text displayed in the image) | ||
| Band Size: 375.0 | Description: 375 wt | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||