PCR:	Generic LacZ
Name of Positive CTRL:	Generic LacZ
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	Generic LacZ foward	793	100 µM	20.0 µl for 1ml	ATCCTCTGCATGGTCAGGTC
	Generic LacZ reverse	792	100 µM	20.0 µl for 1ml	CGTGGCCTGATTCATTCC
Expected Bands:	Band Size: 315.0	Description: 315 Tg	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF