| PCR: | PGRN flox | ||||
| Name of Positive CTRL: | PGRN flox | Annealing Temperature: | 62.0 °C | ||
| Number of cycles: | 35.0 | Extension Time: | 30 s | ||
| Hot Start: | HS 60 | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| PGRN fl fw | 800 | 100 µM | 20.0 µl for 1ml | CCCAGAGTCTCAGCCGTATG | |
| PGRN fl rev | 801 | 100 µM | 20.0 µl for 1ml | CTACTCTGAGGCCACGCACT | |
| Expected Bands: | Band Size: 207.0 | Description: 207 wt | (text displayed in the image) | ||
| Band Size: 270.0 | Description: 270 flox | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||