PCR:	Neo
Name of Positive CTRL:	Generic LacZ
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	120 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	LT a-159 ko	221	100 µM	10.0 µl for 1ml	ata ctt tct cgg cag gag ca
	neomycin F	791	100 µM	10.0 µl for 1ml	GTGAATGAACTGCAGGACGA
Expected Bands:	Band Size: 170.0	Description: 170 neo	(text displayed in the image)
More Information in PDF:		view PDF