PCR:	TITL-GCaMP6f mut
Name of Positive CTRL:	TITL-GCaMP6f mut
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	GCaMP6f-com-for	785	100 µM	20.0 µl for 1ml	ATAGATCCACCTGCCTCTGC
	GCaMP6f-mut-rev	786	100 µM	20.0 µl for 1ml	TCCCCTGGCACAACGTAAG
Expected Bands:	Band Size: 275.0	Description: 275 mut	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF