PCR:	human A30P -SYN
Name of Positive CTRL:	human A30P -SYN
Annealing Temperature:	54.0 °C
Number of cycles:	35.0
Extension Time:	0 s
Hot Start:	HS 53
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	human A30P -SYN F	778	100 µM	20.0 µl for 1ml	ATGGATGTATTCATGAAAGG
	human A30P -SYN R	779	100 µM	20.0 µl for 1ml	TTAGGCTTCAGGTTCGTAG
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
Expected Bands:	Band Size: 225.0	Description: 225 m28s	(text displayed in the image)
	Band Size: 420.0	Description: 420 tg	(text displayed in the image)
More Information in PDF:		view PDF