| PCR: | SAPAP3 NEO |
| Name of Positive CTRL: | SAPAP3 NEO |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| SAPAP3 Commun F | 780 | 100 µM | 30.0 µl for 1ml | ATTGGTAGGCAATACCAACAGG |
| SAPAP3 Neo R | 781 | 100 µM | 20.0 µl for 1ml | CTTTGTGGTTCTAAGTACTGTGG |
| SAPAP3 WT R | 782 | 100 µM | 10.0 µl for 1ml | GCAAAGGCTCTTCATATTGTTGG |
|
| Expected Bands: | Band Size: 150.0 | Description: 150 wt | (text displayed in the image) |
| Band Size: 220.0 | Description: 220 tg | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |